The human NAD(P)H:quinone oxidoreductase (NQO1) gene, 1850 base pairs (bp) of the 5' flanking region, and 67 bp of the 3' flanking region have been sequenced. The human NQO1 gene is approximately 20 kb in length and has six exons interrupted by five introns. The start site of transcription was determined by primer extension analysis. The first exon is 118 bp in length and codes for two amino acids including the initiating methionine and one G for the first codon of the second exon. The sixth exon is the largest among the exons and is 1833 bp in length. The sequence analysis of the sixth exon revealed the presence of four potential polyadenylation signal sequences (AATAAA) and a single copy of human Alu repetitive sequence. The second intron is the smallest of all the introns (116 bp). Nuclear run-on experiments performed using nuclei isolated from 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) treated and untreated human hepatoblastoma (Hep-G2) cells demonstrated that TCDD treatment increases the rate of transcription of endogenous NQO1 gene by 3-fold. The sequence analysis of the 5' flanking region of NQO1 gene showed the presence of a TATA box in the -37 to -32 bp region, one CCAAT box at nucleotide -649, an AP1 binding site at position -462, an AP2 site at nucleotide position -156, and one copy of the nucleotide sequence GCGTG (at position -740) similar to that found in the xenobiotic/dioxin response elements (XREs and DREs) present in the cytochrome P-4501A1 (CYP1A1) gene and known for binding to the Ah receptor-inducer complex and increasing the expression of CYP1A1 gene in response to polycyclic aromatic hydrocarbons (PAHs) and TCDD. The sequence analysis also showed the presence of one copy of an antioxidant response element (ARE) between residues -467 and -447 of the human NQO1 gene. The ARE sequence has recently been identified in the regulatory region of ya subunit of glutathione S-transferase gene and rat NAD(P)H:quinone reductase gene and shown to mediate the basal expression and its induction in response to planar aromatic compounds and phenolic antioxidants. It is noteworthy that XRE in human NQO1 gene is located 5' to the ARE compared to its 3' location in the rat quinone reductase gene. The nucleotide sequence of the ARE characterized in the rat quinone reductase gene is highly conserved in the human NQO1 gene. Interestingly, the consensus sequence for binding to AP1 protein (TGACTCA) is contained within the ARE sequence (TCACAGTGACTCAGCAGAATC) of the human NQO1 gene. The 1850 bp of 5' flanking region of the NQO1 gene containing one copy each of the XRE and the ARE, when attached to the CAT gene and transfected into human hepatoblastoma (Hep-G2) and mouse hepatoma (Hepa-1) cells, increased the expression of CAT gene upon treatment with TCDD. By deletion mutagenesis and transfection studies, we have identified a segment of DNA in the upstream region of the human NQO1 gene (between positions -780 and -365) required for a high level of expression in hepatoma cells and its induction by TCDD.