Classification and identification of Propionibacteria based on ribosomal RNA genes and PCR

A rapid method was developed to differentiate the genus Propionibacterium from other genera by using a modified multiplex-PCR (MPCR) approach. Three 16S rRNA-targeted oligonucleotide primers were designed to amplify simultaneously two DNA-fragments in the MPCR assay. The universal primer pair bak11w and bak4 (corresponding to the E. coli 16S rRNA positions 8-25 and 1522-1540, respectively) was used in combination with the primer pair bak4 and gut (5' - TGCTTTCGATACGGGTTGAC - 3'). The later sequence corresponding to a 16S rRNA motif that is unique for the genus Propionibacterium. Propionibacteria were identified by the amplification of a Propionibacterium-genus specific 900-bp fragment whereas MPCR with DNA from other bacteria generated only a DNA fragment of 1500 bp in amplifications with the two universal primers. The whole procedure including cell lysis, MPCR amplification and analysis can be performed within 1 day, detection limits are at approximately 10(3) cfu propionibacteria (or 35 pg DNA). In addition, the taxonomic situation of the genus Propionibacterium was reexamined using a cycle sequencing strategy. Based on the 16S rDNA, a phylogenetic tree of all the Propionibacterium type strains was reconstructed.