Transactivation of the fucosyltransferase VII gene by human T-cell leukemia virus type 1 Tax through a variant cAMP-responsive element

Human T-cell leukemic virus type 1 (HTLV-1)-infected T cells express the fucosyltransferase (Fuc-T) VII gene involved in the biosynthesis of the leukocyte sialyl Lewis X, which may be related to tissue infiltration in patients with malignant adult T-cell leukemia. HTLV-1 induces Fuc-T VII transcription through the viral transactivator Tax, although the underlying molecular mechanism remains unknown. In the present study, we analyzed the role of the cis-activating element in Tax activation using reporter constructs bearing the 5'-regulatory region of Fuc-T VII in Jurkat T cells. A sequence (GGCTGTGGGGGCGTCATATTGCCCTGG) covering a half-palindromic cyclic adenosine monophosphate (cAMP)-responsive element (CRE) was found to be required for Tax activation of the Fuc-T VII promoter. We further demonstrated that transcription factors of the CRE-binding protein (CREB)/activating transcription factor (ATF) family bind to this CRE-like sequence and that Tax binds in association with CREB and the coactivator CREB-binding protein (CBP) in Jurkat T cells. This element, containing the G+C-rich flanking sequences, is homologous to the Tax-responsive viral CREs in the HTLV-1 long terminal repeat (LTR)-promoter. Furthermore, CREMalpha, an isoform of CREB deficient in the glutamine-rich domains, was found to activate the Fuc-T VII promoter in a phosphorylation-independent manner, similar to the viral CRE in HTLV-1 LTR but in contrast to the phosphorylation-dependent activation of the cellular CREs by Tax. These findings indicate that the Fuc-T VII promoter is transactivated by Tax in concert with CBP through a CRE-like sequence in a manner similar to that of viral CRE in HTLV-1 LTR. (C) 2003 by The American Society of Hematology.