A two-tube real-time assay, developed in a LightCycler(TM), was used to detect. identify and differentiate Campylobacter jejuni and Campylobacter coli from all other pathogenic members of the family Campylobacteriaceae. In the first assay, continuous monitoring of the fluorescence resonance energy transfer (FRET) signal acquired from the hybridisation of two adjacent fluoroprobes, a specific FITC probe (5'-GTGCTAGCTTGCTAGAACTTAGAGA-FITC-3') and a universal downstream probe Cy5 (5'-Cy5-AGGTGITGCATGGITGTCGTTGTCGPO(4)-3'), to the 681-base pair 16S rRNA gene arnplicon target (Escherichia coli position 1024-1048 and 1050-1075. respectively) produced by the primer pair, F2 (ATCTAATGGCTTAACCATTAAAC, E. coli position 783) and Cain-Rev (AATACTAAACTAGTTACCGTC, L coli position 1464), detected C. coli, C. lari and C. jejuni. As expected, a Tm of 65 degreesC was derived from the temperature-dependent probe DNA strand disassociation. In the second assay, an increase in fluorescence due to binding of the intercalating dye SYBR Green I to the DNA amplicons of the hippuricase gene (hipO) (produced by the primer pair hip2214F and hip2474R) was observed for C. jejuni but not for C coli which lacks the hip0 gene. A Tm of 85 +/- 0.5 and 56 degreesC determined from temperature-dependent dye-DNA disassociation identified C. jejuni and the non-specific PCR products, respectively, in line with our expectation. The two-tube assay was subsequently used to identify,, and differentiate the 169 Campylobacteriaceae isolates of animal, human, plant and bird origin held in our culture collection into C coli (74 isolates), C. jejuni (86 isolates) and non-C. coli-C. jejuni (9 isolates). In addition, the method successfully detected C. jejuni, C. roli and C. lari from 24-h enrichment cultures initiated from 30 commercial chicken samples. (C) 2004 Elsevier SAS. All rights reserved.